AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Related tags

Data Analysisbioinformaticscomparisondnarnasecondary-structurenucleic-acids
Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

These can be installed by typing in the command prompt either :

./setup

or

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

  • structures followed by secondary structures written in dotbracket format
  • files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]]

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 "> 
$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 "> 
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

You might also like...
The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

null 1 Dec 9, 2021
Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

Sebastian Schäfer 10 Dec 8, 2022
Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

John McCambridge 79 Sep 20, 2022
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

null 2 Jul 22, 2022
WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

Michael Milton 1 Oct 26, 2021
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

Najibulloh Asror 2 Feb 10, 2022
My first Python project is a simple Mad Libs program.
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

Carson Johnson 1 Dec 10, 2021
simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

aliaksandr-master 0 Jan 26, 2022
Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

Yap Khai Chuen 7 Dec 15, 2022
Comments
  • Allow comparison with not folded secondary structure

    Allow comparison with not folded secondary structure

    User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

    • Give a default distance value to unfolded vs folded structure (worst solution)
    • Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:
      • How to manage with enhancement #7 ? Take the largest ? Shortest ?
      • It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.
    • Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.
    enhancement 
    opened by GitHuBinet 0
  • Different length support and optimal alignment

    Different length support and optimal alignment

    Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.

    enhancement 
    opened by GitHuBinet 0
  • Is the algorithm time consuming ?

    Is the algorithm time consuming ?

    Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

    • [ ] Think about the possibility of improving this bracket search.
    • [ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)
    • [x] #6
    • [ ] Test the algorithm with this new feature
    question 
    opened by GEC-git 0
  • G-quadruplex/pseudoknot comprehension

    G-quadruplex/pseudoknot comprehension

    Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

    The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

    • [ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))
    • [x] #5
    enhancement invalid 
    opened by GEC-git 0
Releases(v0.9-pre-release)

  • v0.9-pre-release(Oct 28, 2022)

    Pre-release content

    https://github.com/GEC-git/AptaMat

    • Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2
    • main script AptaMat.py
    • README.MD edited and published
    • Beta AptaMat logo edited and published

    Contributors

    • @GEC-git contributed in https://github.com/GEC-git/AptaMat
    • @GitHuBinet contributed in https://github.com/GEC-git/AptaMat

    Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release

    Source code(tar.gz)
    Source code(zip)
Owner
GEC UTC
We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.
GEC UTC
GitHub Repository
Convert tables stored as images to an usable .csv file

Convert an image of numbers to a .csv file This Python program aims to convert images of array numbers to corresponding .csv files. It uses OpenCV for

711 Dec 26, 2022
Pipetools enables function composition similar to using Unix pipes.

Pipetools Complete documentation pipetools enables function composition similar to using Unix pipes. It allows forward-composition and piping of arbit

186 Dec 29, 2022
Processo de ETL (extração, transformação, carregamento) realizado pela equipe no projeto final do curso da Soul Code Academy.

Processo de ETL (extração, transformação, carregamento) realizado pela equipe no projeto final do curso da Soul Code Academy.

Débora Mendes de Azevedo 1 Feb 03, 2022
CaterApp is a cross platform, remotely data sharing tool created for sharing files in a quick and secured manner.

CaterApp is a cross platform, remotely data sharing tool created for sharing files in a quick and secured manner. It is aimed to integrate this tool with several more features including providing a U

Ravi Prakash 3 Jun 27, 2021
Using Python to scrape some basic player information from www.premierleague.com and then use Pandas to analyse said data.

PremiershipPlayerAnalysis Using Python to scrape some basic player information from www.premierleague.com and then use Pandas to analyse said data. No

5 Sep 06, 2021
Elementary is an open-source data reliability framework for modern data teams. The first module of the framework is data lineage.

Data lineage made simple, reliable, and automated. Effortlessly track the flow of data, understand dependencies and analyze impact. Features Visualiza

898 Jan 09, 2023
A model checker for verifying properties in epistemic models

Epistemic Model Checker This is a model checker for verifying properties in epistemic models. The goal of the model checker is to check for Pluralisti

Thomas Träff 2 Dec 22, 2021
Candlestick Pattern Recognition with Python and TA-Lib

Candlestick-Pattern-Recognition-with-Python-and-TA-Lib Goal Look at the S&P500 to try and get a better understanding of these candlestick patterns and

Ganesh Jainarain 11 Oct 07, 2022
Probabilistic reasoning and statistical analysis in TensorFlow

TensorFlow Probability TensorFlow Probability is a library for probabilistic reasoning and statistical analysis in TensorFlow. As part of the TensorFl

3.8k Jan 05, 2023
Validated, scalable, community developed variant calling, RNA-seq and small RNA analysis

Validated, scalable, community developed variant calling, RNA-seq and small RNA analysis. You write a high level configuration file specifying your in

Blue Collar Bioinformatics 917 Jan 03, 2023
Tuplex is a parallel big data processing framework that runs data science pipelines written in Python at the speed of compiled code

Tuplex is a parallel big data processing framework that runs data science pipelines written in Python at the speed of compiled code. Tuplex has similar Python APIs to Apache Spark or Dask, but rather

Tuplex 791 Jan 04, 2023
Techdegree Data Analysis Project 2

Basketball Team Stats Tool In this project you will be writing a program that reads from the "constants" data (PLAYERS and TEAMS) in constants.py. Thi

2 Oct 23, 2021
Used for data processing in machine learning, and help us to construct ML model more easily from scratch

Used for data processing in machine learning, and help us to construct ML model more easily from scratch. Can be used in linear model, logistic regression model, and decision tree.

ShawnWang 0 Jul 05, 2022
Time ranges with python

timeranges Time ranges. Read the Docs Installation pip timeranges is available on pip: pip install timeranges GitHub You can also install the latest v

Micael Jarniac 2 Sep 01, 2022
We're Team Arson and we're using the power of predictive modeling to combat wildfires.

We're Team Arson and we're using the power of predictive modeling to combat wildfires. Arson Map Inspiration There’s been a lot of wildfires in Califo

Jerry Lee 3 Oct 17, 2021
A probabilistic programming language in TensorFlow. Deep generative models, variational inference.

Edward is a Python library for probabilistic modeling, inference, and criticism. It is a testbed for fast experimentation and research with probabilis

Blei Lab 4.7k Jan 09, 2023
An ETL framework + Monitoring UI/API (experimental project for learning purposes)

Fastlane An ETL framework for building pipelines, and Flask based web API/UI for monitoring pipelines. Project structure fastlane |- fastlane: (ETL fr

Dan Katz 2 Jan 06, 2022
Employee Turnover Analysis

Employee Turnover Analysis Submission to the DataCamp competition "Can you help reduce employee turnover?"

Jannik Wiedenhaupt 1 Feb 13, 2022
Python ELT Studio, an application for building ELT (and ETL) data flows.

The Python Extract, Load, Transform Studio is an application for performing ELT (and ETL) tasks. Under the hood the application consists of a two parts.

Schlerp 55 Nov 18, 2022
Open-Domain Question-Answering for COVID-19 and Other Emergent Domains

Open-Domain Question-Answering for COVID-19 and Other Emergent Domains This repository contains the source code for an end-to-end open-domain question

7 Sep 27, 2022