produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
SH-PUBLIC is a python based cloning script. You can clone unlimited UID facebook accounts by using this tool.

SH-PUBLIC is a python based cloning script. You can clone unlimited UID facebook accounts by using this tool. This tool works on any Android devices without root.

(Md. Tanvir Ahmed) 5 Mar 09, 2022
A thing to simplify listening for PG notifications with asyncpg

A thing to simplify listening for PG notifications with asyncpg

ANNA 18 Dec 23, 2022
PyHook is an offensive API hooking tool written in python designed to catch various credentials within the API call.

PyHook is the python implementation of my SharpHook project, It uses various API hooks in order to give us the desired credentials. PyHook Uses

Ilan Kalendarov 158 Dec 22, 2022
A simple tool to extract python code from a Jupyter notebook, and then run pylint on it for static analysis.

Jupyter Pylinter A simple tool to extract python code from a Jupyter notebook, and then run pylint on it for static analysis. If you find this tool us

Edmund Goodman 10 Oct 13, 2022
Application for easy configuration of swap file and swappiness priority in slackware and others linux distributions.

Swap File Program created with the objective of assisting in the configuration of swap file in Distributions such as Slackware. Required packages: pyt

Mauricio Ferrari 3 Aug 06, 2022
Tools to connect to and interact with the Mila cluster

milatools The milatools package provides the mila command, which is meant to help with connecting to and interacting with the Mila cluster. Install Re

Mila 32 Dec 01, 2022
[P]ython [w]rited [B]inary [C]onverter

pwbinaryc [P]ython [w]rited [Binary] [C]onverter You have rights to: Modify the code and use it private (friends are allowed too) Make a page and redi

0 Jun 21, 2022
Finger is a function symbol recognition engine for binary programs

Finger is a function symbol recognition engine for binary programs

332 Jan 01, 2023
Similar looking domain detection using python fuzzywuzzy

Major cause of phishing and BEC incident is similar looking domain, if you detect it early, you can prevent incidents early, python fuzzywuzzy module let you do that

2 Nov 07, 2021
Python code to divide big numbers

divide-big-num Python code to divide big numbers

VuMinhNgoc 1 Oct 15, 2021
A simple API that will return a key-value pair of randomly generated UUID

A simple API that will return a key-value pair of randomly generated UUID. Key will be a timestamp and value will be UUID. While the server is running, whenever the API is called, it should return al

Pius Lucky 2 Jan 18, 2022
Gradually automate your procedures, one step at a time

Gradualist Gradually automate your procedures, one step at a time Inspired by https://blog.danslimmon.com/2019/07/15/ Features Main Features Converts

Ross Jacobs 8 Jul 24, 2022
A work in progress box containing various Python utilities

python-wipbox A set of modern Python libraries under development to simplify the execution of reusable routines by different projects. Table of Conten

Deepnox 2 Jan 20, 2022
This tool analyzes the json files generated by stream-lnd-htlcs to find hidden channel demand.

analyze_lnd_htlc Introduction Rebalancing channels is an important part of running a Lightning Network node. While it would be great if all channels c

Marimox 4 Dec 08, 2022
Easy compression and extraction for any compression or archival format.

Tzar: Tar, Zip, Anything Really Easy compression and extraction for any compression or archival format. Usage/Examples tzar compress large-dir compres

DanielVZ 37 Nov 02, 2022
Hide new MacBook Pro notch with black wallpaper.

Hide new MacBook Pro notch with black wallpaper.

Wang Chao 1 Oct 27, 2021
✨ Un générateur de mot de passe aléatoire totalement fait en Python par moi, et en français.

Password Generator ❗ Un générateur de mot de passe aléatoire totalement fait en Python par moi, et en français. 🔮 Grâce a une au module random et str

MrGabin 3 Jul 29, 2021
This repository contains some utilities for playing with PKINIT and certificates.

PKINIT tools This repository contains some utilities for playing with PKINIT and certificates. The tools are built on minikerberos and impacket. Accom

Dirk-jan 395 Dec 27, 2022
🦩 A Python tool to create comment-free Jupyter notebooks.

Pelikan Pelikan lets you convert notebooks to comment-free notebooks. In other words, It removes Python block and inline comments from source cells in

Hakan Özler 7 Nov 20, 2021
Python Yeelight YLKG07YL/YLKG08YL dimmer handler

With this class you can receive, decrypt and handle Yeelight YLKG07YL/YLKG08YL dimmer bluetooth notifications in your python code.

12 Dec 26, 2022