produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
A hashtag from string extract python module

A hashtag from string extract python module

Fayas Noushad 3 Aug 10, 2022
Homebase Name Changer for Fortnite: Save the World.

Homebase Name Changer This program allows you to change the Homebase name in Fortnite: Save the World. How to use it? After starting the HomebaseNameC

PRO100KatYT 7 May 21, 2022
A random cats photos python module

A random cats photos python module

Fayas Noushad 6 Dec 01, 2021
Utility to extract Fantasy Grounds Unity Line-of-sight and lighting files from a Univeral VTT file exported from Dungeondraft

uvtt2fgu Utility to extract Fantasy Grounds Unity Line-of-sight and lighting files from a Univeral VTT file exported from Dungeondraft This program wo

Andre Kostur 29 Dec 05, 2022
python-codicefiscale: a tiny library for encode/decode Italian fiscal code - codifica/decodifica del Codice Fiscale.

python-codicefiscale python-codicefiscale is a tiny library for encode/decode Italian fiscal code - codifica/decodifica del Codice Fiscale. Features T

Fabio Caccamo 53 Dec 14, 2022
A simulator for xkcd 2529's weirdly concrete problem

What is this? This is a quick hack implementation of a simulator for xkcd 2529's weirdly concrete problem. This is barely tested and I suck at computa

Reuben Steenekamp 6 Oct 27, 2021
Writing Alfred copy/paste scripts in Python

Writing Alfred copy/paste scripts in Python This repository shows how to create Alfred scripts in Python. It assumes that you using pyenv for Python v

Will Fitzgerald 2 Oct 26, 2021
✨ Voici un code en Python par moi, et en français qui permet de générer du texte Lorem.

Lorem Gen ❗ Voici un code en Python par moi, et en français qui permet de générer du texte Lorem. Dépendences : pip install lorem_text 💖 Enjoy 🎫 Mon

MrGabin 3 Jun 07, 2021
Personal Toolbox Package

Jammy (Jam) A personal toolbox by Qsh.zh. Usage setup For core package, run pip install jammy To access functions in bin git clone https://gitlab.com/

5 Sep 16, 2022
This utility synchronises spelling dictionaries from various tools with each other.

This utility synchronises spelling dictionaries from various tools with each other. This way the words that have been trained on MS Office are also correctly checked in vim or Firefox. And vice versa

Patrice Neff 2 Feb 11, 2022
A simple example for calling C++ functions in Python by `ctypes`.

ctypes-example A simple example for calling C++ functions in Python by ctypes. Features call C++ function int bar(int* value, char* msg) with argumene

Yusu Pan 3 Nov 23, 2022
Find unused resource keys in properties files in a Salesforce Commerce Cloud project and get rid of them.

Find Unused Resource Keys Find unused resource keys in properties files in a Salesforce Commerce Cloud project and get rid of them. It looks through a

Noël 5 Jan 08, 2022
Script to autocompound 3commas BO:SO based on user provided risk factor

3commas_compounder Script to autocompound 3commas BO:SO based on user provided risk factor Setup Step 1 git clone this repo into your working director

0 Feb 24, 2022
Entropy-controlled contexts in Python

Python module ordered ordered module is the opposite to random - it maintains order in the program. import random x = 5 def increase(): global x

HyperC 36 Nov 03, 2022
Package that allows for validate and sanitize of string values.

py.validator A library of string validators and sanitizers Insipired by validator.js Strings only This library validates and sanitizes strings only. P

Sanel Hadzini 22 Nov 08, 2022
Every 2 minutes, check for visa slots at VFS website

vfs-visa-slot-germany Every 2 minutes, check for visa slots at VFS website. If there are any, send a call and a message of the format: Sent from your

12 Dec 15, 2022
A BlackJack simulator in Python to simulate thousands or millions of hands using different strategies.

BlackJack Simulator (in Python) A BlackJack simulator to play any number of hands using different strategies The Rules To keep the code relatively sim

Hamid 4 Jun 24, 2022
EthTx - Ethereum transactions decoder

EthTx - Ethereum transactions decoder Installation pip install ethtx Requirements The package needs a few external resources, defined in EthTxConfig o

398 Dec 25, 2022
An online streamlit development platform

streamlit-playground An online streamlit development platform Run, Experiment and Play with streamlit Components Develop full-fledged apps online All

Akshansh Kumar 3 Nov 06, 2021
jfc is an utility to make reviewing ArXiv papers for your Journal Club easier.

jfc is an utility to make reviewing ArXiv papers for your Journal Club easier.

Miguel M. 3 Dec 20, 2021