Soap comparison result file description

Preface

More , Please visit mine Personal blog .

---

soap yes genomics The development of a short sequence alignment software （ Software home page ）. But it's a pity , This website is no longer maintained .

Because I have undertaken an old project now （2012 Year of ）, Used in the project soap comparison , Therefore, the results of the comparison software on the Internet are summarized here .

soap Format files can be opened with a plain text editor , Some of the contents are as follows ：

CL100152537L1C001R001_82        TTATAAATAAAACTCCCATCTCCCTGGGACAGAGC     FFEGGEFGDGGGFGFGGFGGGFGGF;@BAFF;[email protected]     18      a       35      +       chr8    89537925        0       35M     35
CL100152537L1C001R001_100       AGAAAACACTCCCTCAGGGAAGTGCCAGCCCTCCT     >[email protected]?DGFGGEGGFGB7?7FAAF>GF9BBGFGGGF     1       a       35      +       chr11   65819516        1       G->15A2 35M     15G19
...

From left to right , Sequential representation ：

• Number ：read The number of .
• read Sequence ： If read Compare the negative chain of the upper reference sequence , Will be reverse complemented into a positive chain .
• Mass value ： The quality value of the sequence , Consistent with sequence order , If read Reverse complementarity , The mass value will also change with .
• The number of comparisons ： The times of comparison . There is no comparison read Will be ignored .
• a/b：pair-end Compared markers , Express read From which file .
• length ：read length , If it is a tolerance comparison , The length will be the length of the missing fragment .
• +/-： Compare the positive or negative chains of the upper reference sequence .
• Chromosome name ： Chromosome name of the reference sequence .
• site ： The position of the first base on the chromosome , from 1 Start .
• Number of mismatches ： The default is 0.
• Details of the mismatch ：G->15A2 It means a mismatch , The position in the reference sequence is the position of +15（ from 0 Start ）, On the reference sequence is G,read On is A, Mass value is 2.
• Compare the numbers on the ：35M intend 35 Base pairs are matched .
• Details of the comparison ：15G19 It means before 15 A comparison has been made , The first 16（ Position on the reference sequence +16） One is a mismatch , Back 19 The two are still comparable .

---